Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116231
Name   oriT_pE843-27 in_silico
Organism   Enterococcus lactis strain E843
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP082268 (1112..1149 [+], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      14..22, 29..37  (TAAAGTATA..TATACTTTA)
 2..8, 13..19  (ACTTTAT..ATAAAGT)
Location of nic site      27..28
Conserved sequence flanking the
  nic site  
 
 GTGTGTTATA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_pE843-27
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16664 GenBank   NZ_CP082268
Plasmid name   pE843-27 Incompatibility group   -
Plasmid size   27847 bp Coordinate of oriT [Strand]   1112..1149 [+]
Host baterium   Enterococcus lactis strain E843

Cargo genes


Drug resistance gene   fexB, poxtA, tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -