Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116182
Name   oriT_155105|p1_155105 in_silico
Organism   Enterobacter sp. 155105
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP104978 (4114..4173 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_155105|p1_155105
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16615 GenBank   NZ_CP104978
Plasmid name   155105|p1_155105 Incompatibility group   Col440I
Plasmid size   4648 bp Coordinate of oriT [Strand]   4114..4173 [+]
Host baterium   Enterobacter sp. 155105

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -