Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116179
• Name: oriT_pW47-2
• Organism: Proteus mirabilis strain W47
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP104988 (947..1006 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pW47-2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 16612
• GenBank: NZ_CP104988
• Plasmid name: pW47-2
• Incompatibility group: ColRNAI
• Plasmid size: 2742 bp
• Coordinate of oriT [Strand]: 947..1006 [-]
• Host baterium: Proteus mirabilis strain W47

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -