Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116179
Name   oriT_pW47-2 in_silico
Organism   Proteus mirabilis strain W47
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP104988 (947..1006 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pW47-2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16612 GenBank   NZ_CP104988
Plasmid name   pW47-2 Incompatibility group   ColRNAI
Plasmid size   2742 bp Coordinate of oriT [Strand]   947..1006 [-]
Host baterium   Proteus mirabilis strain W47

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -