Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116154 |
| Name | oriT_pKAM645_12  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM645 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026432 (1188..1243 [-], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pKAM645_12
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16587 | GenBank | NZ_AP026432 |
| Plasmid name | pKAM645_12 | Incompatibility group | - |
| Plasmid size | 1585 bp | Coordinate of oriT [Strand] | 1188..1243 [-] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM645 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |