Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116103 |
| Name | oriT_pEmeLPU88b  |
| Organism | Sinorhizobium meliloti strain LPU88 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MZ505104 (8405..8461 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 4..9, 23..28 (GGAAAA..TTTTCC) 6..11, 20..25 (AAAATG..CATTTT) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TCCTGCCTCT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pEmeLPU88b
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCTCTCCAAATTGTAAGGGGA
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCTCTCCAAATTGTAAGGGGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16536 | GenBank | NZ_MZ505104 |
| Plasmid name | pEmeLPU88b | Incompatibility group | - |
| Plasmid size | 35933 bp | Coordinate of oriT [Strand] | 8405..8461 [-] |
| Host baterium | Sinorhizobium meliloti strain LPU88 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |