Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116017
Name   oriT_NCDC 599-52|p4 in_silico
Organism   Shigella dysenteriae strain NCDC 599-52
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP119455 (346..405 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_NCDC 599-52|p4
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16450 GenBank   NZ_CP119455
Plasmid name   NCDC 599-52|p4 Incompatibility group   Col
Plasmid size   1822 bp Coordinate of oriT [Strand]   346..405 [+]
Host baterium   Shigella dysenteriae strain NCDC 599-52

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -