Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116016 |
| Name | oriT_NCDC 599-52|p3  |
| Organism | Shigella dysenteriae strain NCDC 599-52 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP119454 (1916..1990 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | 12..17, 20..25 (GCCCTG..CAGGGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_NCDC 599-52|p3
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16449 | GenBank | NZ_CP119454 |
| Plasmid name | NCDC 599-52|p3 | Incompatibility group | ColRNAI |
| Plasmid size | 2679 bp | Coordinate of oriT [Strand] | 1916..1990 [+] |
| Host baterium | Shigella dysenteriae strain NCDC 599-52 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |