Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116016
Name   oriT_NCDC 599-52|p3 in_silico
Organism   Shigella dysenteriae strain NCDC 599-52
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP119454 (1916..1990 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)      12..17, 20..25  (GCCCTG..CAGGGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_NCDC 599-52|p3
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16449 GenBank   NZ_CP119454
Plasmid name   NCDC 599-52|p3 Incompatibility group   ColRNAI
Plasmid size   2679 bp Coordinate of oriT [Strand]   1916..1990 [+]
Host baterium   Shigella dysenteriae strain NCDC 599-52

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -