Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116015 |
| Name | oriT_NCDC 599-52|p2  |
| Organism | Shigella dysenteriae strain NCDC 599-52 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP119453 (4518..4592 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_NCDC 599-52|p2
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16448 | GenBank | NZ_CP119453 |
| Plasmid name | NCDC 599-52|p2 | Incompatibility group | ColRNAI |
| Plasmid size | 5153 bp | Coordinate of oriT [Strand] | 4518..4592 [+] |
| Host baterium | Shigella dysenteriae strain NCDC 599-52 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |