Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116013
Name   oriT_CIP 56-18|p2 in_silico
Organism   Shigella boydii strain CIP 56-18
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP119448 (3769..3828 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_CIP 56-18|p2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16446 GenBank   NZ_CP119448
Plasmid name   CIP 56-18|p2 Incompatibility group   ColRNAI
Plasmid size   4065 bp Coordinate of oriT [Strand]   3769..3828 [-]
Host baterium   Shigella boydii strain CIP 56-18

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -