Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115983 |
| Name | oriT_223|p223E  |
| Organism | Lactococcus lactis subsp. lactis strain 223 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP031928 (8041..8175 [+], 135 nt) |
| oriT length | 135 nt |
| IRs (inverted repeats) | 21..29, 38..46 (AAAGGGGAA..TTCCCCTTT) |
| Location of nic site | 102..103 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 135 nt
>oriT_223|p223E
CGACACAATCCAAAGGGGATAAAGGGGAAAGTGAAACTTCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGGTTTATATTTCCTATTTTGTT
CGACACAATCCAAAGGGGATAAAGGGGAAAGTGAAACTTCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGGTTTATATTTCCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16416 | GenBank | NZ_CP031928 |
| Plasmid name | 223|p223E | Incompatibility group | - |
| Plasmid size | 13653 bp | Coordinate of oriT [Strand] | 8041..8175 [+] |
| Host baterium | Lactococcus lactis subsp. lactis strain 223 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |