Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115950 |
| Name | oriT_FAHZZU5722|unnamed5  |
| Organism | Enterobacter asburiae strain FAHZZU5722 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP135267 (3622..3673 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_FAHZZU5722|unnamed5
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16383 | GenBank | NZ_CP135267 |
| Plasmid name | FAHZZU5722|unnamed5 | Incompatibility group | - |
| Plasmid size | 4935 bp | Coordinate of oriT [Strand] | 3622..3673 [+] |
| Host baterium | Enterobacter asburiae strain FAHZZU5722 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |