Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115920
Name   oriT_pMQB_Silv108.8 in_silico
Organism   Raoultella ornithinolytica strain MQB_Silv_108
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP104464 (1..59 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pMQB_Silv108.8
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16353 GenBank   NZ_CP104464
Plasmid name   pMQB_Silv108.8 Incompatibility group   -
Plasmid size   716 bp Coordinate of oriT [Strand]   1..59 [-]
Host baterium   Raoultella ornithinolytica strain MQB_Silv_108

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -