Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115901 |
| Name | oriT_pTT13-6  |
| Organism | Paracoccus yeei strain TT13 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP024428 (23160..23192 [+], 33 nt) |
| oriT length | 33 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 33 nt
>oriT_pTT13-6
GCGAAGCGGAAGAGTTTGCATAAGTGCGCCCTT
GCGAAGCGGAAGAGTTTGCATAAGTGCGCCCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16334 | GenBank | NZ_CP024428 |
| Plasmid name | pTT13-6 | Incompatibility group | - |
| Plasmid size | 24567 bp | Coordinate of oriT [Strand] | 23160..23192 [+] |
| Host baterium | Paracoccus yeei strain TT13 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | cutO |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |