Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115873
Name   oriT_BFG-299|unnamed1 in_silico
Organism   Bacteroides ovatus strain BFG-299
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP103131 (10937..11110 [+], 174 nt)
oriT length   174 nt
IRs (inverted repeats)      57..63, 66..72  (CAATGGC..GCCATTG)
 18..23, 37..42  (AACTAC..GTAGTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 174 nt

>oriT_BFG-299|unnamed1
CCCTCGGGAGAGCCCACAACTACGTAAGCGGAGCGTGTAGTTATAGTGGGCTATATCAATGGCAAGCCATTGTCTGCAAACTCCAGCCTACGGCTTCCGCTCTCCTCCGTCAGGGAGGTTTTTCATCATCGTTGCCGATTGGAGATGCACCGACCAGCACAAGGTCTAAATCGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16306 GenBank   NZ_CP103131
Plasmid name   BFG-299|unnamed1 Incompatibility group   -
Plasmid size   11598 bp Coordinate of oriT [Strand]   10937..11110 [+]
Host baterium   Bacteroides ovatus strain BFG-299

Cargo genes


Drug resistance gene   cfxA
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -