Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115869 |
| Name | oriT_pTR2  |
| Organism | Flavobacterium sp. TR2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP104308 (1778..1852 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pTR2
GTCGGGGCGAAGCCCTGACCAAGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAAGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16302 | GenBank | NZ_CP104308 |
| Plasmid name | pTR2 | Incompatibility group | ColRNAI |
| Plasmid size | 3003 bp | Coordinate of oriT [Strand] | 1778..1852 [-] |
| Host baterium | Flavobacterium sp. TR2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |