Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115823
Name   oriT_pEh23_5 in_silico
Organism   Enterobacter hormaechei strain Ehh_23
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP126772 (2613..2672 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pEh23_5
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16256 GenBank   NZ_CP126772
Plasmid name   pEh23_5 Incompatibility group   -
Plasmid size   3372 bp Coordinate of oriT [Strand]   2613..2672 [-]
Host baterium   Enterobacter hormaechei strain Ehh_23

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -