Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 115797
• Name: oriT_p600657_8
• Organism: Shigella boydii strain 600657
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP049284 (976..1035 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_p600657_8
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 16230
• GenBank: NZ_CP049284
• Plasmid name: p600657_8
• Incompatibility group: ColRNAI
• Plasmid size: 8379 bp
• Coordinate of oriT [Strand]: 976..1035 [+]
• Host baterium: Shigella boydii strain 600657

Cargo genes

• Drug resistance gene: sul2, aph(3'')-Ib, aph(6)-Id, tet(A)
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -