Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115733 |
| Name | oriT_pJM4G |
| Organism | Lactococcus cremoris strain JM4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP122377 (5916..6053 [+], 138 nt) |
| oriT length | 138 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 138 nt
>oriT_pJM4G
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGTTTGCCAGTATTTATGGGTTTATATTTCCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGTTTGCCAGTATTTATGGGTTTATATTTCCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16166 | GenBank | NZ_CP122377 |
| Plasmid name | pJM4G | Incompatibility group | - |
| Plasmid size | 12180 bp | Coordinate of oriT [Strand] | 5916..6053 [+] |
| Host baterium | Lactococcus cremoris strain JM4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |