Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115584
Name   oriT_pHL23187 in_silico
Organism   Staphylococcus aureus strain HL23187
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP080771 (13796..14035 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 37..42, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_pHL23187
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTAGTTTTGTGACAAATACTGTATATAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16017 GenBank   NZ_CP080771
Plasmid name   pHL23187 Incompatibility group   -
Plasmid size   20724 bp Coordinate of oriT [Strand]   13796..14035 [+]
Host baterium   Staphylococcus aureus strain HL23187

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21