Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115536 |
| Name | oriT_pBP5067_P9 |
| Organism | Enterococcus faecium strain BP5067 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP059815 (1150..1326 [-], 177 nt) |
| oriT length | 177 nt |
| IRs (inverted repeats) | 91..97, 107..113 (ATTTTTT..AAAAAAT) 92..98, 105..111 (TTTTTTG..CAAAAAA) 26..34, 37..45 (CACCTTCCT..AGGAAGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 177 nt
>oriT_pBP5067_P9
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15969 | GenBank | NZ_CP059815 |
| Plasmid name | pBP5067_P9 | Incompatibility group | - |
| Plasmid size | 2056 bp | Coordinate of oriT [Strand] | 1150..1326 [-] |
| Host baterium | Enterococcus faecium strain BP5067 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |