Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115521 |
| Name | oriT_S103|unnamed2  |
| Organism | Ligilactobacillus salivarius strain S103 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP114528 (60016..60069 [+], 54 nt) |
| oriT length | 54 nt |
| IRs (inverted repeats) | 16..22, 28..34 (TCCCCAC..GTGGGGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 54 nt
>oriT_S103|unnamed2
GTTGATACTGTCAACTCCCCACCGTGCGTGGGGACAGTTTTCCTTATGCTCTTT
GTTGATACTGTCAACTCCCCACCGTGCGTGGGGACAGTTTTCCTTATGCTCTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15954 | GenBank | NZ_CP114528 |
| Plasmid name | S103|unnamed2 | Incompatibility group | - |
| Plasmid size | 213659 bp | Coordinate of oriT [Strand] | 60016..60069 [+] |
| Host baterium | Ligilactobacillus salivarius strain S103 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIC1 |