Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 115515 |
Name | oriT_SK11|2 |
Organism | Lactococcus cremoris subsp. cremoris SK11 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NC_008504 (5988..6124 [+], 137 nt) |
oriT length | 137 nt |
IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
Location of nic site | 104..105 |
Conserved sequence flanking the nic site |
GCTTGCAGTA |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_SK11|2
CGACACACTCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGGTTTATATTTCCTATTTTGTT
CGACACACTCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGGTTTATATTTCCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 15948 | GenBank | NC_008504 |
Plasmid name | SK11|2 | Incompatibility group | - |
Plasmid size | 9554 bp | Coordinate of oriT [Strand] | 5988..6124 [+] |
Host baterium | Lactococcus cremoris subsp. cremoris SK11 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |