Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115512 |
| Name | oriT_p-1.411_2  |
| Organism | Latilactobacillus sakei strain TMW 1.411 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM010626 (27..64 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_p-1.411_2
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15945 | GenBank | NZ_CM010626 |
| Plasmid name | p-1.411_2 | Incompatibility group | - |
| Plasmid size | 6593 bp | Coordinate of oriT [Strand] | 27..64 [+] |
| Host baterium | Latilactobacillus sakei strain TMW 1.411 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |