Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115511
Name   oriT_p-1.411_1 in_silico
Organism   Latilactobacillus sakei strain TMW 1.411
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM010625 (10261..10298 [+], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      1..6, 20..25  (ACACCA..TGGTGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_p-1.411_1
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15944 GenBank   NZ_CM010625
Plasmid name   p-1.411_1 Incompatibility group   -
Plasmid size   11246 bp Coordinate of oriT [Strand]   10261..10298 [+]
Host baterium   Latilactobacillus sakei strain TMW 1.411

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -