Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115483 |
| Name | oriT_pSJ05684a  |
| Organism | Sinorhizobium sojae CCBAU 05684 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP023069 (39723..39779 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 4..9, 23..28 (GGAAAA..TTTTCC) 6..11, 20..25 (AAAATG..CATTTT) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TCCTGCCCCT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSJ05684a
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 399744..408815
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SJ05684_RS29330 (SJ05684_a41120) | 394906..395199 | + | 294 | Protein_389 | helix-turn-helix domain-containing protein | - |
| SJ05684_RS30895 | 395222..395551 | - | 330 | WP_015633592 | DUF5372 family protein | - |
| SJ05684_RS29340 | 395530..395787 | + | 258 | Protein_391 | IS21 family transposase | - |
| SJ05684_RS29345 | 395828..396058 | + | 231 | Protein_392 | AAA family ATPase | - |
| SJ05684_RS29350 | 396194..396427 | - | 234 | WP_010875417 | helix-turn-helix domain-containing protein | - |
| SJ05684_RS29355 (SJ05684_a41170) | 396646..396969 | + | 324 | WP_014858045 | transcriptional repressor TraM | - |
| SJ05684_RS29930 | 396973..397685 | - | 713 | Protein_395 | autoinducer binding domain-containing protein | - |
| SJ05684_RS29370 (SJ05684_a41210) | 397988..399282 | - | 1295 | Protein_396 | IncP-type conjugal transfer protein TrbI | - |
| SJ05684_RS29375 (SJ05684_a41220) | 399294..399740 | - | 447 | WP_014858040 | conjugal transfer protein TrbH | - |
| SJ05684_RS29380 (SJ05684_a41230) | 399744..400556 | - | 813 | WP_014858039 | P-type conjugative transfer protein TrbG | virB9 |
| SJ05684_RS29385 (SJ05684_a41240) | 400574..401236 | - | 663 | WP_014858038 | conjugal transfer protein TrbF | virB8 |
| SJ05684_RS29390 (SJ05684_a41250) | 401260..402435 | - | 1176 | WP_034859627 | P-type conjugative transfer protein TrbL | virB6 |
| SJ05684_RS29395 (SJ05684_a41260) | 402429..402626 | - | 198 | WP_014858036 | entry exclusion protein TrbK | - |
| SJ05684_RS29400 (SJ05684_a41270) | 402623..403426 | - | 804 | WP_014858035 | P-type conjugative transfer protein TrbJ | virB5 |
| SJ05684_RS29405 (SJ05684_a41280) | 403398..405629 | - | 2232 | Protein_403 | conjugal transfer protein TrbE | - |
| SJ05684_RS29410 (SJ05684_a41290) | 405707..406729 | + | 1023 | WP_014328393 | IS110 family transposase | - |
| SJ05684_RS29415 (SJ05684_a41300) | 406929..407162 | - | 234 | WP_014858033 | hypothetical protein | virb4 |
| SJ05684_RS29420 (SJ05684_a41310) | 407173..407472 | - | 300 | WP_010875429 | conjugal transfer protein TrbD | virB3 |
| SJ05684_RS29425 (SJ05684_a41320) | 407465..407848 | - | 384 | WP_034859524 | TrbC/VirB2 family protein | virB2 |
| SJ05684_RS29430 (SJ05684_a41330) | 407838..408815 | - | 978 | WP_015633597 | P-type conjugative transfer ATPase TrbB | virB11 |
| SJ05684_RS29435 (SJ05684_a41360) | 408826..409452 | - | 627 | WP_014858030 | acyl-homoserine-lactone synthase | - |
Host bacterium
| ID | 15916 | GenBank | NZ_CP023069 |
| Plasmid name | pSJ05684a | Incompatibility group | - |
| Plasmid size | 410255 bp | Coordinate of oriT [Strand] | 39723..39779 [-] |
| Host baterium | Sinorhizobium sojae CCBAU 05684 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | gmd |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | nodA, nodB, nodC, nodI, nodJ, nifS, fixU, nifZ, nifB, fixX, fixC, fixB, fixA, nifH, nifD, nifE, nifN, nifX, nodD, nodZ, noeL, nolV, nolU, nolT, nopB, nolW, nolX, mLTONO_5203, nifK |
| Anti-CRISPR | AcrIC6 |