Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115425 |
| Name | oriT_pNTUH_1027 |
| Organism | Staphylococcus aureus strain NTUH_1027 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LC377537 (1121..1309 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 163..168, 178..183 (ATTTTA..TAAAAT) 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) 41..46, 48..53 (AAGTGT..ACACTT) 31..39, 44..52 (AGTGTCACA..TGTGACACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pNTUH_1027
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15858 | GenBank | NZ_LC377537 |
| Plasmid name | pNTUH_1027 | Incompatibility group | - |
| Plasmid size | 35303 bp | Coordinate of oriT [Strand] | 1121..1309 [+] |
| Host baterium | Staphylococcus aureus strain NTUH_1027 |
Cargo genes
| Drug resistance gene | blaZ, aph(2'')-Ia, erm(B) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |