Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115349 |
| Name | oriT_pLs13-a  |
| Organism | Latilactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP017930 (839..876 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pLs13-a
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15783 | GenBank | NZ_AP017930 |
| Plasmid name | pLs13-a | Incompatibility group | - |
| Plasmid size | 6214 bp | Coordinate of oriT [Strand] | 839..876 [-] |
| Host baterium | Latilactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |