Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 115322
• Name: oriT_pR23
• Organism: Enterobacter sp. W001
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_015515 (8514..8572 [+], 59 nt)
• oriT length: 59 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 59 nt

>oriT_pR23
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGGAGCACTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 15757
• GenBank: NC_015515
• Plasmid name: pR23
• Incompatibility group: ColRNAI
• Plasmid size: 10497 bp
• Coordinate of oriT [Strand]: 8514..8572 [+]
• Host baterium: Enterobacter sp. W001

Cargo genes

• Drug resistance gene: aac(6')-Ib, ant(3'')-Ia, blaOXA-9, blaTEM-1A
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -