Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115293 |
| Name | oriT_pLF24  |
| Organism | Companilactobacillus farciminis KCTC 3681 = DSM 20184 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_011798 (1155..1192 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pLF24
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15729 | GenBank | NC_011798 |
| Plasmid name | pLF24 | Incompatibility group | - |
| Plasmid size | 2396 bp | Coordinate of oriT [Strand] | 1155..1192 [+] |
| Host baterium | Companilactobacillus farciminis KCTC 3681 = DSM 20184 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |