Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115265 |
| Name | oriT_pKA1-2  |
| Organism | Klebsiella quasipneumoniae strain KA1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102895 (36773..36871 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 26..31, 40..45 (GTGATA..TATCAC) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pKA1-2
TTTGTTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15701 | GenBank | NZ_CP102895 |
| Plasmid name | pKA1-2 | Incompatibility group | - |
| Plasmid size | 85913 bp | Coordinate of oriT [Strand] | 36773..36871 [+] |
| Host baterium | Klebsiella quasipneumoniae strain KA1 |
Cargo genes
| Drug resistance gene | aph(6)-Id, aph(3'')-Ib, tet(A), sul1, qnrB2, qacE, aadA16, dfrA27, ARR-3, aac(6')-Ib-cr, floR, sul2, aph(4)-Ia, aac(3)-IVa |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |