Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115263
Name   oriT_pKW4-3 in_silico
Organism   Klebsiella quasipneumoniae strain KW4
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP102906 (5382..5475 [+], 94 nt)
oriT length   94 nt
IRs (inverted repeats)      73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 94 nt

>oriT_pKW4-3
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15699 GenBank   NZ_CP102906
Plasmid name   pKW4-3 Incompatibility group   IncFIA
Plasmid size   13970 bp Coordinate of oriT [Strand]   5382..5475 [+]
Host baterium   Klebsiella quasipneumoniae strain KW4

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -