Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115252 |
| Name | oriT_pLH1  |
| Organism | Lactobacillus helveticus DSM 20075 = CGMCC 1.1877 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_002102 (4504..4640 [-], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_pLH1
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTGCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTGCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15688 | GenBank | NC_002102 |
| Plasmid name | pLH1 | Incompatibility group | - |
| Plasmid size | 19360 bp | Coordinate of oriT [Strand] | 4504..4640 [-] |
| Host baterium | Lactobacillus helveticus DSM 20075 = CGMCC 1.1877 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |