Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115249
Name   oriT_pAK51 in_silico
Organism   Escherichia sp. Sflu5
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_009716 (981..1040 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAK51
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15685 GenBank   NC_009716
Plasmid name   pAK51 Incompatibility group   ColRNAI
Plasmid size   6511 bp Coordinate of oriT [Strand]   981..1040 [+]
Host baterium   Escherichia sp. Sflu5

Cargo genes


Drug resistance gene   blaTEM-181, tet(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -