Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115247
Name   oriT_pKKTET7 in_silico
Organism   Shigella sonnei
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_008439 (4624..4683 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKKTET7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15682 GenBank   NC_008439
Plasmid name   pKKTET7 Incompatibility group   ColRNAI
Plasmid size   8401 bp Coordinate of oriT [Strand]   4624..4683 [+]
Host baterium   Shigella sonnei

Cargo genes


Drug resistance gene   tet(A), sul2, aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -