Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115246
Name   oriT_pET3xa-barn36 in_silico
Organism   Bacillus intermedius
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_025174 (2931..2990 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pET3xa-barn36
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15681 GenBank   NC_025174
Plasmid name   pET3xa-barn36 Incompatibility group   ColRNAI
Plasmid size   4753 bp Coordinate of oriT [Strand]   2931..2990 [-]
Host baterium   Bacillus intermedius

Cargo genes


Drug resistance gene   blaTEM-1A
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -