Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115221
Name   oriT_pE-CRECL423 in_silico
Organism   Enterobacter hormaechei strain CRECL423
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP133341 (534..593 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pE-CRECL423
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15656 GenBank   NZ_CP133341
Plasmid name   pE-CRECL423 Incompatibility group   Col440II
Plasmid size   5258 bp Coordinate of oriT [Strand]   534..593 [-]
Host baterium   Enterobacter hormaechei strain CRECL423

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -