Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115218
Name   oriT_pD-CRECL416 in_silico
Organism   Enterobacter asburiae strain CRECL416
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP133355 (4483..4542 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pD-CRECL416
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15653 GenBank   NZ_CP133355
Plasmid name   pD-CRECL416 Incompatibility group   ColRNAI
Plasmid size   4956 bp Coordinate of oriT [Strand]   4483..4542 [+]
Host baterium   Enterobacter asburiae strain CRECL416

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -