Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115209 |
| Name | oriT_p3-KQ20605  |
| Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain KQ20605 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP133208 (23841..23940 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 27..32, 41..46 (GTGATA..TATCAC) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | 60..61 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_p3-KQ20605
TTTGTTTTTTTTGCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTGCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15644 | GenBank | NZ_CP133208 |
| Plasmid name | p3-KQ20605 | Incompatibility group | IncR |
| Plasmid size | 54658 bp | Coordinate of oriT [Strand] | 23841..23940 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. similipneumoniae strain KQ20605 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | ncrA, nirB, ncrC, nirD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |