Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115197 |
| Name | oriT_pJM1G  |
| Organism | Lactococcus cremoris strain JM1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016751 (4599..4736 [+], 138 nt) |
| oriT length | 138 nt |
| IRs (inverted repeats) | 85..91, 93..99 (TATTACA..TGTAATA) 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 138 nt
>oriT_pJM1G
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTAATAGCTTGCCAGTATTTATGGTTTTATATGGTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTAATAGCTTGCCAGTATTTATGGTTTTATATGGTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15632 | GenBank | NZ_CP016751 |
| Plasmid name | pJM1G | Incompatibility group | - |
| Plasmid size | 10866 bp | Coordinate of oriT [Strand] | 4599..4736 [+] |
| Host baterium | Lactococcus cremoris strain JM1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |