Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 115175 |
| Name | oriT_pCV56E  |
| Organism | Lactococcus lactis subsp. lactis CV56 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_017488 (1123..1158 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pCV56E
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15610 | GenBank | NC_017488 |
| Plasmid name | pCV56E | Incompatibility group | - |
| Plasmid size | 2262 bp | Coordinate of oriT [Strand] | 1123..1158 [+] |
| Host baterium | Lactococcus lactis subsp. lactis CV56 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |