Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 115083
• Name: oriT_SJC1044|4
• Organism: Serratia marcescens strain SJC1044
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OX291774 (1382..1439 [+], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_SJC1044|4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 15518
• GenBank: NZ_OX291774
• Plasmid name: SJC1044|4
• Incompatibility group: Col440II
• Plasmid size: 3223 bp
• Coordinate of oriT [Strand]: 1382..1439 [+]
• Host baterium: Serratia marcescens strain SJC1044

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -