Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   115070
Name   oriT_pX9 in_silico
Organism   Staphylococcus aureus strain X9
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP080003 (5722..5961 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 37..42, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_pX9
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTAGTTTTGTGACAAATACTGTATATAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15505 GenBank   NZ_CP080003
Plasmid name   pX9 Incompatibility group   -
Plasmid size   20317 bp Coordinate of oriT [Strand]   5722..5961 [+]
Host baterium   Staphylococcus aureus strain X9

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21