Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 115064 |
Name | oriT_SJC1062|6 |
Organism | Serratia marcescens strain SJC1062 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_OX291479 (748..805 [+], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_SJC1062|6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 15499 | GenBank | NZ_OX291479 |
Plasmid name | SJC1062|6 | Incompatibility group | Col440II |
Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 748..805 [+] |
Host baterium | Serratia marcescens strain SJC1062 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |