Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114993
Name   oriT_pKM98_p4 in_silico
Organism   Enterobacter hormaechei strain 21KM1498
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP126868 (9784..9843 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKM98_p4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   15428 GenBank   NZ_CP126868
Plasmid name   pKM98_p4 Incompatibility group   Col440I
Plasmid size   9923 bp Coordinate of oriT [Strand]   9784..9843 [+]
Host baterium   Enterobacter hormaechei strain 21KM1498

Cargo genes


Drug resistance gene   aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -