Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114981 |
| Name | oriT_pEh25_3  |
| Organism | Enterobacter hormaechei strain Ehh_25 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP126748 (105175..105274 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 79..84, 90..95 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pEh25_3
ATTTGGTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATGAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
ATTTGGTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATGAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15416 | GenBank | NZ_CP126748 |
| Plasmid name | pEh25_3 | Incompatibility group | IncY |
| Plasmid size | 121071 bp | Coordinate of oriT [Strand] | 105175..105274 [+] |
| Host baterium | Enterobacter hormaechei strain Ehh_25 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | ugd, wbtL |
| Metal resistance gene | merE, merD, merA, merC, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |