Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 114977 |
Name | oriT_pEh15_4 |
Organism | Enterobacter hormaechei strain Ehh_15 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP126802 (5956..6014 [-], 59 nt) |
oriT length | 59 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pEh15_4
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 15412 | GenBank | NZ_CP126802 |
Plasmid name | pEh15_4 | Incompatibility group | ColRNAI |
Plasmid size | 6165 bp | Coordinate of oriT [Strand] | 5956..6014 [-] |
Host baterium | Enterobacter hormaechei strain Ehh_15 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |