Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114968 |
| Name | oriT_pYH16056-1  |
| Organism | Acinetobacter sp. YH16056_T |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP094546 (60134..60237 [+], 104 nt) |
| oriT length | 104 nt |
| IRs (inverted repeats) | 63..70, 73..80 (CACCATGC..GCATGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 104 nt
>oriT_pYH16056-1
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15403 | GenBank | NZ_CP094546 |
| Plasmid name | pYH16056-1 | Incompatibility group | - |
| Plasmid size | 98709 bp | Coordinate of oriT [Strand] | 60134..60237 [+] |
| Host baterium | Acinetobacter sp. YH16056_T |
Cargo genes
| Drug resistance gene | blaOXA-58, aac(3)-IId, dfrA16, aph(3')-Ia, tet(X3), sul2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |