Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114853 |
| Name | oriT_pL22-1 |
| Organism | Klebsiella quasipneumoniae strain L22 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP031258 (104874..104901 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_pL22-1
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 15288 | GenBank | NZ_CP031258 |
| Plasmid name | pL22-1 | Incompatibility group | IncFIB |
| Plasmid size | 212635 bp | Coordinate of oriT [Strand] | 104874..104901 [-] |
| Host baterium | Klebsiella quasipneumoniae strain L22 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iroB, iroC, iroD, iroN, rmpA, iutA, iucC, iucB, iucA |
| Metal resistance gene | terW, terZ, terA, terB, terC, terD, terE, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |