Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 114833
• Name: oriT_M2901|unnamed4
• Organism: Shigella flexneri strain M2901
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP058593 (2164..2223 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_M2901|unnamed4
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 15268
• GenBank: NZ_CP058593
• Plasmid name: M2901|unnamed4
• Incompatibility group: ColRNAI
• Plasmid size: 4082 bp
• Coordinate of oriT [Strand]: 2164..2223 [+]
• Host baterium: Shigella flexneri strain M2901

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -