Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 114801 |
| Name | oriT_147_1_TBG_A|plas3  |
| Organism | Escherichia albertii strain 147_1_TBG_A |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP099901 (43655..43707 [-], 53 nt) |
| oriT length | 53 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 53 nt
>oriT_147_1_TBG_A|plas3
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1710..24046
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NIZ13_RS23930 (NIZ13_23915) | 1071..1706 | - | 636 | WP_000934978 | A24 family peptidase | - |
| NIZ13_RS23935 (NIZ13_23920) | 1710..2192 | - | 483 | WP_023226007 | lytic transglycosylase domain-containing protein | virB1 |
| NIZ13_RS23940 (NIZ13_23925) | 2279..2818 | - | 540 | WP_256879696 | type 4 pilus major pilin | - |
| NIZ13_RS23945 (NIZ13_23930) | 2863..3441 | - | 579 | WP_256879697 | type II secretion system F family protein | - |
| NIZ13_RS23950 (NIZ13_23935) | 3429..3977 | - | 549 | WP_256879698 | type II secretion system F family protein | - |
| NIZ13_RS23955 (NIZ13_23940) | 4000..5517 | - | 1518 | WP_256879699 | GspE/PulE family protein | virB11 |
| NIZ13_RS23960 (NIZ13_23945) | 5542..6036 | - | 495 | WP_000912553 | type IV pilus biogenesis protein PilP | - |
| NIZ13_RS23965 (NIZ13_23950) | 6020..7333 | - | 1314 | WP_256879700 | type 4b pilus protein PilO2 | - |
| NIZ13_RS24870 | 7384..9023 | - | 1640 | Protein_9 | PilN family type IVB pilus formation outer membrane protein | - |
| NIZ13_RS24875 | 9074..11037 | - | 1964 | Protein_10 | type IV secretory system conjugative DNA transfer family protein | - |
| NIZ13_RS23990 (NIZ13_23975) | 11053..12119 | - | 1067 | Protein_11 | P-type DNA transfer ATPase VirB11 | - |
| NIZ13_RS23995 (NIZ13_23980) | 12138..13277 | - | 1140 | WP_001542008 | TrbI/VirB10 family protein | virB10 |
| NIZ13_RS24000 (NIZ13_23985) | 13267..13518 | - | 252 | WP_306296651 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| NIZ13_RS24005 (NIZ13_23990) | 13560..14036 | - | 477 | Protein_14 | TrbG/VirB9 family P-type conjugative transfer protein | - |
| NIZ13_RS24010 (NIZ13_23995) | 14033..14767 | - | 735 | WP_000432282 | virB8 family protein | virB8 |
| NIZ13_RS24015 (NIZ13_24000) | 14933..17293 | - | 2361 | WP_256879706 | conjugal transfer protein | virb4 |
| NIZ13_RS24020 (NIZ13_24005) | 17299..17622 | - | 324 | WP_256879707 | VirB3 family type IV secretion system protein | virB3 |
| NIZ13_RS24025 (NIZ13_24010) | 17693..17983 | - | 291 | WP_032210188 | TrbC/VirB2 family protein | - |
| NIZ13_RS24030 (NIZ13_24015) | 17983..18483 | - | 501 | WP_256879708 | lytic transglycosylase domain-containing protein | virB1 |
| NIZ13_RS24035 (NIZ13_24020) | 18587..18988 | - | 402 | WP_256879709 | hypothetical protein | - |
| NIZ13_RS24040 (NIZ13_24025) | 19108..19545 | - | 438 | WP_000539665 | type IV pilus biogenesis protein PilM | - |
| NIZ13_RS24045 (NIZ13_24030) | 19551..20786 | - | 1236 | WP_000733394 | TcpQ domain-containing protein | - |
| NIZ13_RS24050 (NIZ13_24035) | 20789..21088 | - | 300 | WP_000835763 | TrbM/KikA/MpfK family conjugal transfer protein | - |
| NIZ13_RS24055 (NIZ13_24040) | 21136..21945 | + | 810 | WP_170172038 | DUF5710 domain-containing protein | - |
| NIZ13_RS24060 (NIZ13_24045) | 22168..22392 | - | 225 | WP_000713561 | EexN family lipoprotein | - |
| NIZ13_RS24065 (NIZ13_24050) | 22401..23045 | - | 645 | WP_001310442 | type IV secretion system protein | - |
| NIZ13_RS24070 (NIZ13_24055) | 23051..24046 | - | 996 | WP_001028541 | type IV secretion system protein | virB6 |
| NIZ13_RS24075 (NIZ13_24060) | 24050..24307 | - | 258 | WP_000739144 | hypothetical protein | - |
| NIZ13_RS24080 (NIZ13_24065) | 24304..24606 | - | 303 | WP_001485001 | hypothetical protein | - |
| NIZ13_RS24085 (NIZ13_24070) | 24878..25531 | - | 654 | WP_053899054 | hypothetical protein | - |
| NIZ13_RS24090 (NIZ13_24075) | 25542..25712 | - | 171 | WP_001131281 | hypothetical protein | - |
| NIZ13_RS24095 (NIZ13_24080) | 25716..26159 | - | 444 | WP_256879710 | NfeD family protein | - |
| NIZ13_RS24100 (NIZ13_24085) | 26221..27174 | - | 954 | WP_072089442 | SPFH domain-containing protein | - |
| NIZ13_RS24105 (NIZ13_24090) | 27220..27414 | - | 195 | WP_001127356 | DUF1187 family protein | - |
| NIZ13_RS24110 (NIZ13_24095) | 27407..27859 | - | 453 | WP_226454419 | CaiF/GrlA family transcriptional regulator | - |
Host bacterium
| ID | 15236 | GenBank | NZ_CP099901 |
| Plasmid name | 147_1_TBG_A|plas3 | Incompatibility group | IncI2 |
| Plasmid size | 53352 bp | Coordinate of oriT [Strand] | 43655..43707 [-] |
| Host baterium | Escherichia albertii strain 147_1_TBG_A |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |