Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   114801
Name   oriT_147_1_TBG_A|plas3 in_silico
Organism   Escherichia albertii strain 147_1_TBG_A
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099901 (43655..43707 [-], 53 nt)
oriT length   53 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 53 nt

>oriT_147_1_TBG_A|plas3
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS


T4SS were predicted by using oriTfinder2.

Region 1: 1710..24046

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NIZ13_RS23930 (NIZ13_23915) 1071..1706 - 636 WP_000934978 A24 family peptidase -
NIZ13_RS23935 (NIZ13_23920) 1710..2192 - 483 WP_023226007 lytic transglycosylase domain-containing protein virB1
NIZ13_RS23940 (NIZ13_23925) 2279..2818 - 540 WP_256879696 type 4 pilus major pilin -
NIZ13_RS23945 (NIZ13_23930) 2863..3441 - 579 WP_256879697 type II secretion system F family protein -
NIZ13_RS23950 (NIZ13_23935) 3429..3977 - 549 WP_256879698 type II secretion system F family protein -
NIZ13_RS23955 (NIZ13_23940) 4000..5517 - 1518 WP_256879699 GspE/PulE family protein virB11
NIZ13_RS23960 (NIZ13_23945) 5542..6036 - 495 WP_000912553 type IV pilus biogenesis protein PilP -
NIZ13_RS23965 (NIZ13_23950) 6020..7333 - 1314 WP_256879700 type 4b pilus protein PilO2 -
NIZ13_RS24870 7384..9023 - 1640 Protein_9 PilN family type IVB pilus formation outer membrane protein -
NIZ13_RS24875 9074..11037 - 1964 Protein_10 type IV secretory system conjugative DNA transfer family protein -
NIZ13_RS23990 (NIZ13_23975) 11053..12119 - 1067 Protein_11 P-type DNA transfer ATPase VirB11 -
NIZ13_RS23995 (NIZ13_23980) 12138..13277 - 1140 WP_001542008 TrbI/VirB10 family protein virB10
NIZ13_RS24000 (NIZ13_23985) 13267..13518 - 252 WP_306296651 TrbG/VirB9 family P-type conjugative transfer protein virB9
NIZ13_RS24005 (NIZ13_23990) 13560..14036 - 477 Protein_14 TrbG/VirB9 family P-type conjugative transfer protein -
NIZ13_RS24010 (NIZ13_23995) 14033..14767 - 735 WP_000432282 virB8 family protein virB8
NIZ13_RS24015 (NIZ13_24000) 14933..17293 - 2361 WP_256879706 conjugal transfer protein virb4
NIZ13_RS24020 (NIZ13_24005) 17299..17622 - 324 WP_256879707 VirB3 family type IV secretion system protein virB3
NIZ13_RS24025 (NIZ13_24010) 17693..17983 - 291 WP_032210188 TrbC/VirB2 family protein -
NIZ13_RS24030 (NIZ13_24015) 17983..18483 - 501 WP_256879708 lytic transglycosylase domain-containing protein virB1
NIZ13_RS24035 (NIZ13_24020) 18587..18988 - 402 WP_256879709 hypothetical protein -
NIZ13_RS24040 (NIZ13_24025) 19108..19545 - 438 WP_000539665 type IV pilus biogenesis protein PilM -
NIZ13_RS24045 (NIZ13_24030) 19551..20786 - 1236 WP_000733394 TcpQ domain-containing protein -
NIZ13_RS24050 (NIZ13_24035) 20789..21088 - 300 WP_000835763 TrbM/KikA/MpfK family conjugal transfer protein -
NIZ13_RS24055 (NIZ13_24040) 21136..21945 + 810 WP_170172038 DUF5710 domain-containing protein -
NIZ13_RS24060 (NIZ13_24045) 22168..22392 - 225 WP_000713561 EexN family lipoprotein -
NIZ13_RS24065 (NIZ13_24050) 22401..23045 - 645 WP_001310442 type IV secretion system protein -
NIZ13_RS24070 (NIZ13_24055) 23051..24046 - 996 WP_001028541 type IV secretion system protein virB6
NIZ13_RS24075 (NIZ13_24060) 24050..24307 - 258 WP_000739144 hypothetical protein -
NIZ13_RS24080 (NIZ13_24065) 24304..24606 - 303 WP_001485001 hypothetical protein -
NIZ13_RS24085 (NIZ13_24070) 24878..25531 - 654 WP_053899054 hypothetical protein -
NIZ13_RS24090 (NIZ13_24075) 25542..25712 - 171 WP_001131281 hypothetical protein -
NIZ13_RS24095 (NIZ13_24080) 25716..26159 - 444 WP_256879710 NfeD family protein -
NIZ13_RS24100 (NIZ13_24085) 26221..27174 - 954 WP_072089442 SPFH domain-containing protein -
NIZ13_RS24105 (NIZ13_24090) 27220..27414 - 195 WP_001127356 DUF1187 family protein -
NIZ13_RS24110 (NIZ13_24095) 27407..27859 - 453 WP_226454419 CaiF/GrlA family transcriptional regulator -


Host bacterium


ID   15236 GenBank   NZ_CP099901
Plasmid name   147_1_TBG_A|plas3 Incompatibility group   IncI2
Plasmid size   53352 bp Coordinate of oriT [Strand]   43655..43707 [-]
Host baterium   Escherichia albertii strain 147_1_TBG_A

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -